rs2236386 chr9:124415457 G>C
- Sequence
agaaagcagttccgggtcggaggc[G/C]ggtgcaaacaaaaagagccgagca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293T (embryonic kidney) PC9 (lung adenocarcinoma) tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.09 | 0.94 | 1.81 | |||
| HEK293T (embryonic kidney) | 1.37 | -0.40 | 2.03 | |||
| PC9 (lung adenocarcinoma) | -0.64 | 1.54 | 2.00 | |||
| tibial nerve | 0.47 | 1.13 | 1.11 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Nerve_Tibial, Ovary, Pancreas, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood