rs2237578 chr7:93443009 T>C
- Sequence
acttcagcaccctgccttagtttg[T/C]acggaagcagccacagcttaaaca
- ASB in cell types
- HEK293 (embryonic kidney) pancreas MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.52 | -0.13 | 1.90 | |||
| pancreas | 1.51 | -0.17 | 1.33 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.34 | 0.45 | 1.63 |
Items per page:
1 – 3 of 3