rs2238104 chr12:6078499 G>T
- Sequence
actgaactcagagtgcagatgagg[G/T]tgtcccagagagggtcatgtgctc
- ASB in cell types
- GM12878 (female B-cells) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | -0.02 | 0.85 | 1.33 | |||
| HEK293 (embryonic kidney) | 0.40 | 0.02 | 2.02 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP birth weight, lung function, predicted ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), salmonella-induced pyroptosis