rs2238663 chr19:19146061 G>A
- Sequence
agagagggaggccgtgagctcagc[G/A]aggaagggaaggaagccaggggat
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.27 | 0.85 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.60 | 1.26 | 2.37 | |||
| foreskin keratinocyte | 0.53 | n/a | 2.67 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, eye color, hdl cholesterol change with statins, hip bone mineral density (bmd), schizophrenia, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid