rs2238775 chr22:19769849 G>A
- Sequence
cagacctccagcctccagaactgg[G/A]agaaataactgtccattgttgata
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.52 | 0.72 | 4.13 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Stomach, Thyroid