rs2241718 chr19:41323701 G>A
- Sequence
ctcctgtttacactccccaaatgc[G/A]cacaggctgttatcatgggtcctg
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia) MRC-5 (fetal lung fibroblasts)
- ASB for transcription factors
- HTF4_HUMAN NGN2_HUMAN FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HTF4_HUMAN | 2.34 | 0.42 | 1.56 | n/a | No Hit | |||
| NGN2_HUMAN | 1.06 | -0.05 | 1.33 | n/a | n/a | |||
| FOXA2_HUMAN | -0.47 | 0.67 | 1.33 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), coronary artery disease (cad)
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Pancreas, Spleen, Stomach, Whole_Blood