rs2244181 chr1:38475432 A>G
- Sequence
gtgagcacattcacaggctctgag[A/G]acagagaggtatttaaagtgaact
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.53 | 0.60 | 1.35 |
Items per page:
1 – 1 of 1