rs2244804 chr4:17511835 A>G
- Sequence
gtgcgcgcacgtgcaagcaacacg[A/G]gtcagggggtgcacaggggccccc
- ASB in cell types
- K562 (myelogenous leukemia) neural cell
- ASB for transcription factors
- MNT_HUMAN NRF1_HUMAN EP400_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | 1.85 | -0.73 | 2.00 | n/a | n/a | |||
| NRF1_HUMAN | 1.43 | -2.12 | 2.00 | n/a | No Hit | |||
| EP400_HUMAN | 2.30 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Vagina, Whole_Blood