rs224575 chr12:51025838 T>C
- Sequence
cgctccctgaagtcggttaggtta[T/C]aatgagtcttttgttgaagcgggg
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.92 | -0.09 | 2.01 | |||
| GM12878 (female B-cells) | 0.46 | 0.68 | 1.21 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, hypertension (early onset hypertension), sporadic creutzfeldt-jakob disease, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid