rs2248931 chr10:43420581 C>G
- Sequence
cttccagcgctgccggcggcgggg[C/G]gggtgccgggcgcgcctgctgcgc
- ASB in cell types
- HCT-116 (colon carcinoma) GM12878 (female B-cells)
- ASB for transcription factors
- ZFX_HUMAN MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 2.13 | -1.78 | 1.17 | n/a | No Hit | |||
| MEF2B_HUMAN | n/a | 1.66 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Caudate_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid