rs2249736 chr3:39153971 G>T
- Sequence
gggagcacctcgtaactccgcaag[G/T]ccacgggctagacagtggcagagc
- ASB in cell types
- Peyer's patch GM12878 (female B-cells)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.12 | -0.31 | 1.18 | n/a | No Hit |
Items per page:
1 – 1 of 1