rs2251380 chr14:61485406 G>C
- Sequence
cctggaatacatccacttgacagt[G/C]tcctctctatgccacagccttagg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) LY-2 (invasive ductal carcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.50 | 0.69 | 1.70 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), systolic blood pressure (sbp), waist hip ratio