rs225212 chr17:32569437 C>T
- Sequence
ctcagacctgcatgaccaattctg[C/T]aatagtatctgccacagaaaagac
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.72 | 0.45 | 1.34 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP childhood acute lymphoblastic leukemia, hypertension in premenopausal women with short sleep duration, hypertension in women with short sleep duration, lung function, predicted ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), microalbuminuria