rs2252779 chr7:158948101 C>T
- Sequence
ctgccctggcgctagcgatgcctc[C/T]gggatcttccagaggaaggtgaga
- ASB in cell types
- HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293T (embryonic kidney) | -1.62 | 1.90 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid