rs2255210 chr20:38757660 T>C
- Sequence
acaggaagcttgcttttgcagtga[T/C]gggctcccagctggaggctcgctc
- ASB in cell types
- K562 (myelogenous leukemia) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- E2F1_HUMAN GATA1_HUMAN NFE2_HUMAN EMSY_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| E2F1_HUMAN | n/a | 2.87 | 2.00 | n/a | No Hit | |||
| GATA1_HUMAN | -1.06 | 1.33 | 1.78 | n/a | No Hit | |||
| NFE2_HUMAN | n/a | 1.87 | 2.00 | n/a | No Hit | |||
| EMSY_HUMAN | -2.94 | 2.17 | 2.00 | n/a | n/a | |||
| ZN316_HUMAN | -0.63 | 1.78 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood