rs226005 chr16:21609226 A>G
- Sequence
attgacagaaaccccatggcagcg[A/G]tctctgtggttatccttatgtttc
- ASB in cell types
- CD14+ monocytes macrophages
- ASB for transcription factors
- STAT1_HUMAN CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | -3.47 | 2.34 | 2.50 | n/a | No Hit | |||
| CEBPB_HUMAN | -0.69 | 1.84 | 2.38 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), ldl cholesterol, panic disorder, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Artery_Tibial, Colon_Sigmoid, Colon_Transverse, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood