rs226059 chr16:21301139 A>G
- Sequence
aggaccccgggcctttgggaagtt[A/G]tctgctaaactccagtagaccctg
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.13 | 0.83 | 2.00 | |||
| GM12878 (female B-cells) | 0.64 | 0.38 | 1.30 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid