rs2268477 chr14:81144525 C>A
- Sequence
tctctggagagtgattagtattaa[C/A]ctaatcattgcccccaagaaggaa
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ZR-75-1 (invasive ductal carcinoma) | 1.00 | -0.41 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, hypertriglyceridemia, neuroblastoma (brain cancer), refractive error, sporadic creutzfeldt-jakob disease