rs2268982 chr14:68946087 G>A
- Sequence
ctttcaaccacaggctcagtcagc[G/A]tgactctccccagggcctggcagc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) LY-2 (invasive ductal carcinoma) ZR-75-1 (invasive ductal carcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.38 | 0.95 | 1.68 | -0.52 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
