rs2268983 chr14:68941980 G>A
- Sequence
ctcctccctgagggacaaccaccc[G/A]gcagcagccacatgactttgcaaa
- ASB in cell types
- A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma) H1 (embryonic stem cells)
- ASB for transcription factors
- RAD21_HUMAN SMC3_HUMAN JUN_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.16 | 1.22 | 1.87 | n/a | n/a | |||
| SMC3_HUMAN | -0.19 | 1.19 | 2.09 | n/a | n/a | |||
| JUN_HUMAN | -0.22 | 1.04 | 2.06 | n/a | No Hit | |||
| CTCF_HUMAN | 0.43 | 0.81 | 1.54 | -3.89 | Discordant |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), college completion, homa-ir, nicotine dependence (smoking), quantity, obesity with early age of onset (age >2), years of education
PheWAS abnormality of red blood cells, adverse effects of cardiac rhythm regulators, altered mental status, arthralgia/ankylosis of temporomandibular joint, benign neoplasm of other endocrine glands, blood vessel replaced, cachexia, calculus of kidney, cellulitis and abscess of hand/fingers, cholelithiasis with other cholecystitis, chronic liver disease and cirrhosis, chronic lymphoid leukemia, chronic nonalcoholic liver disease, chronic periodontitis, chronic renal failure, concussion, congenital anomalies of lower limb, including pelvic girdle, cystic mastopathy, dermatophytosis, discoid lupus erythematosus, diseases of the jaws, disorders of adrenal glands, endocarditis, esophageal cancer, essential hypertension, exostosis of jaw, fracture of radius and ulna, gestational diabetes, gingival and periodontal diseases, glomerulonephritis, gout, gout and other crystal arthropathies, gouty arthropathy, hearing loss, hepatic cancer, hepatic cancer, primary, hereditary and idiopathic peripheral neuropathy, herpes zoster, hodgkins disease, hx of malignant neoplasm of oral cavity and pharynx, hypersomnia, hypertension, hypertensive chronic kidney disease, hypertensive heart and/or renal disease, intracranial hemorrhage, large cell lymphoma, leukoplakia of oral mucosa, malignant neoplasm of kidney and other urinary organs, mechanical complications of cardiac/vascular device, implant, and graft, muscle weakness, neuralgia, neuritis, and radiculitis nos, obsessive-compulsive disorder, open wound of lip and mouth, open wounds of head, neck, and trunk, oral aphthae, other cells and casts in urine, other congenital anomalies of skin, other diseases of respiratory system, ovarian dysfunction, parkinsons disease, periodontitis (acute or chronic), periostitis, pilonidal cyst, plasma protein metabolism disorder, pneumonitis due to inhalation of food or vomitus, poisoning by agents primarily affecting blood constituents, polycystic ovaries, protein plasma/amino-acid transport and metabolism disorder, pyogenic granuloma, renal dialysis, sensorineural hearing loss, sepsis and sirs, stress incontinence, female, swelling, mass, or lump in head and neck, symptoms involving head and neck, temporomandibular joint disorders, unspecified erythematous condition, urticaria, valvular heart disease/ heart chambers
GTEx eQTL Artery_Aorta, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg