rs2270281 chr2:200812731 C>T
- Sequence
cgctgttgcggtcacaggcatgac[C/T]tagggtaggatggtgctgcccgta
- ASB in cell types
- foreskin keratinocyte neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.67 | 2.17 | 2.17 | |||
| neural cell | -0.07 | 0.84 | 1.00 |
Items per page:
1 – 2 of 2