rs2274980 chr1:183215481 C>T
- Sequence
tcttagtgctcgatgtgacaactc[C/T]ggacggtgcagctgtaaaccaggt
- ASB in cell types
- dermal fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| dermal fibroblasts | 1.93 | -1.87 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis