rs2277090 chr6:84227812 T>C
- Sequence
aatgcctttccttccctggctttc[T/C]ctacgttccttagaaaaggggaca
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells) macrophages foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN ZBT20_HUMAN ZXDB_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.56 | 0.75 | 1.24 | n/a | No Hit | |||
| ZBT20_HUMAN | n/a | 2.62 | 2.00 | n/a | n/a | |||
| ZXDB_HUMAN | n/a | 2.54 | 2.00 | n/a | n/a | |||
| FOXK2_HUMAN | 1.65 | -1.90 | 1.33 | n/a | n/a | |||
| ZNF34_HUMAN | -1.96 | 1.95 | 1.50 | n/a | n/a |
Items per page:
1 – 5 of 13
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, rheumatoid arthritis, taste change in healthy volunteers in response to topiramate treatment (normal taste), urinary albumin-to-creatinine ratio