rs227728 chr17:56699494 T>A
- Sequence
gtcaggaagtgacactaaaatgcc[T/A]ttccccttatacctcgttcagcct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma) SK-N-SH (neuroblastoma)
- ASB for transcription factors
- SIN3A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SIN3A_HUMAN | 0.71 | 2.04 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1