rs2277514 chr14:90256715 T>C
- Sequence
aactgggacagccctcttctcctt[T/C]tgccggcctgatcttctcggcggg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.14 | 0.62 | 1.49 | |||
| A549 (lung carcinoma) | -0.05 | 0.68 | 2.00 |
Items per page:
1 – 2 of 2