rs2277876 chr2:99181135 G>A
- Sequence
tttcgccggaacaaaaatgcctca[G/A]tttggaggtcgcgctcactgcgac
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells) HeLa S3 (cervical adenocarcinoma) monocyte-derived macrophages
- ASB for transcription factors
- FOXK2_HUMAN E4F1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 3.09 | 0.13 | 1.75 | n/a | n/a | |||
| E4F1_HUMAN | 2.49 | -3.11 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood