rs227859 chr14:22479482 C>T
- Sequence
acttaagtaaatatcaaggggagt[C/T]tgggcaactgagtttttgtagatc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | -2.17 | 1.80 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, fasting blood glucose, neuroblastoma (brain cancer), partial epilepsy