rs2278601 chr15:66701900 G>A
- Sequence
aggcaaagcgccccgtttgcgtcc[G/A]agtctcagtgggtccgccgagcct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.98 | -0.08 | 1.67 | |||
| HEK293 (embryonic kidney) | 0.49 | 0.62 | 1.35 |
Items per page:
1 – 2 of 2