rs227867 chr14:22484872 A>G
- Sequence
ctttgggtgcctgtctgtttgagg[A/G]cctcagctgagggcaggcatctgg
- ASB in cell types
- SK-N-BE(2)-C (neuroblastoma)
- ASB for transcription factors
- TWST1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TWST1_HUMAN | -1.64 | 1.99 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, mitral annular calcium, neuroblastoma (brain cancer), tetrology of fallot, triglycerides, urinary albumin-to-creatinine ratio, variant creutzfeldt-jakob disease, waist hip ratio