rs2279944 chr1:201043119 C>T
- Sequence
gctggccaaagaagcctctgccat[C/T]gaggtcggcctcttacattaaggt
- ASB in cell types
- K562 (myelogenous leukemia) kidney breast tumor tissue
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.60 | 1.06 | 2.80 | |||
| kidney | 2.22 | -2.06 | 2.00 | |||
| breast tumor tissue | 1.78 | n/a | 2.50 |
Items per page:
1 – 3 of 3