rs2280099 chr4:89114398 A>G
- Sequence
aaacagaactgaatccagagaagc[A/G]tattagccataaagcggcacttga
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 1.78 | -1.68 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, height, lp-pla2 activity, partial epilepsy, schizophrenia, spine bone mineral density (bmd), stabilized warfarin dose, triglycerides change with statins