rs2280858 chr8:23547867 A>G
- Sequence
acagccccgccctggaatcaaggg[A/G]agaagtgtggcagatgcttctgga
- ASB in cell types
- K562 (myelogenous leukemia) liver
- ASB for transcription factors
- HNF4A_HUMAN MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | 1.57 | n/a | 1.33 | n/a | No Hit | |||
| MNT_HUMAN | 0.23 | 1.65 | 1.88 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial