rs2286708 chr7:23014329 G>C
- Sequence
aatgggcgtgatccgggcgtccga[G/C]ggaagttgattgactgtaaggttt
- ASB in cell types
- GM12878 (female B-cells) HepG2 (hepatoblastoma) CD14+ monocytes
- ASB for transcription factors
- FOXK2_HUMAN STAT1_HUMAN GABP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 2.37 | 0.36 | 1.33 | n/a | n/a | |||
| STAT1_HUMAN | 1.55 | n/a | 2.50 | n/a | No Hit | |||
| GABP1_HUMAN | -1.48 | 1.85 | 1.33 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Skin_Not_Sun_Exposed_Suprapubic, Testis, Whole_Blood