rs2286809 chr11:22829909 A>G
- Sequence
ggcaacgccccgcccccaccccgc[A/G]gctctgccccgcctcgcctctctg
- ASB in cell types
- bipolar neuron K562 (myelogenous leukemia) IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | -0.53 | 1.15 | 1.17 | |||
| K562 (myelogenous leukemia) | 0.91 | -0.31 | 2.00 | |||
| IPSC-derived bipolar neuron | -0.02 | 1.49 | 1.00 |
Items per page:
1 – 3 of 3