rs2288856 chr19:56368605 T>G
- Sequence
gtggcgggtgccttacaagaatgc[T/G]cgcgtgatcagtgtgttggcgttt
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
- ASB for transcription factors
- NRF1_HUMAN LMBL2_HUMAN EGR1_HUMAN RING2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 2.02 | n/a | 2.00 | 3.85 | Discordant | |||
| LMBL2_HUMAN | 2.84 | n/a | 2.00 | n/a | n/a | |||
| EGR1_HUMAN | 2.53 | -0.74 | 2.00 | n/a | No Hit | |||
| RING2_HUMAN | 2.56 | n/a | 2.00 | n/a | n/a | |||
| NFIC_HUMAN | 2.41 | -3.55 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 9
Motif analysis
Genetic associations
GRASP infant head circumference, late onset alzheimers disease, ldl cholesterol, ldl cholesterol change with statins, spine bone mineral density (bmd), tetrology of fallot, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Pituitary, Testis, Thyroid