rs2289074 chr11:9614829 G>T
- Sequence
gtatttattcaggtccatcagaga[G/T]tcttaatctggggtatggggacaa
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
- ASB for transcription factors
- COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | n/a | 1.59 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi), lp-pla2 mass, mitral annular calcium, primary rhegmatogenous retinal detachment, resistance to kuru in aged women despite likely exposure
GTEx eQTL Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg