rs2289193 chr2:11779372 G>A
- Sequence
gcgcttccctgccccctggtggcc[G/A]gaggagggatttgtcatgaggctc
- ASB in cell types
- NCI-H2171 (small cell lung carcinoma) CD34+ stem cells-derived erythroblasts retinoblastoma xenograft WERI-Rb-1 (retinoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| NCI-H2171 (small cell lung carcinoma) | -0.49 | 1.40 | 1.50 | |||
| CD34+ stem cells-derived erythroblasts | 1.92 | 0.70 | 2.00 | |||
| retinoblastoma xenograft | 2.02 | -1.60 | 2.00 | |||
| WERI-Rb-1 (retinoblastoma) | 1.93 | -2.46 | 1.50 |
Items per page:
1 – 4 of 4