rs228925 chr22:37111602 A>T
- Sequence
catgtgtggagtgtgaggcgtgtg[A/T]gtggagtgtgcagcgggtgtgaag
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.25 | 0.49 | 1.95 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, aortic valve calcium, mitral annular calcium, obesity with early age of onset (age >2), rheumatoid arthritis