rs2292611 chr3:184135073 A>G
- Sequence
ggcgaccacaagtcctatcacgcc[A/G]caagaatctcggcttgttcaccta
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma) breast tumor tissue
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.62 | 0.43 | 1.52 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.46 | 0.69 | 1.45 | |||
| breast tumor tissue | 1.78 | n/a | 2.50 |
Items per page:
1 – 3 of 3