rs2292863 chr17:47291764 C>G
- Sequence
accaccatgtgggattgtgtggtg[C/G]aaaatagtgctttgtgcatcttgc
- ASB in cell types
- K562 (myelogenous leukemia) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN IKZF1_HUMAN ZN316_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 2.61 | 1.32 | 1.83 | n/a | No Hit | |||
| IKZF1_HUMAN | -3.35 | 2.56 | 2.00 | n/a | No Hit | |||
| ZN316_HUMAN | -1.93 | 1.74 | 2.00 | n/a | n/a | |||
| SMCA4_HUMAN | -1.79 | 1.88 | 2.00 | n/a | n/a | |||
| ATF3_HUMAN | -2.95 | 2.29 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood