rs229664 chr14:64704859 C>A
- Sequence
ggggcgaccgaggagggcctggaa[C/A]tgtgttggctgcttcccgggccac
- ASB in cell types
- HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293T (embryonic kidney) | 0.90 | -0.07 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Minor_Salivary_Gland, Pancreas, Pituitary, Prostate, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood