rs2297177 chr9:122261695 G>A
- Sequence
tgggacaactgctctggcagccag[G/A]gcacacaagctgccatttaaggtg
- ASB in cell types
- breast tumour metastasis HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumour metastasis | -3.25 | 2.40 | 1.50 | |||
| HepG2 (hepatoblastoma) | 0.16 | 0.59 | 1.28 |
Items per page:
1 – 2 of 2