rs229965 chr5:57718473 A>G
- Sequence
tccatatttacaggaataaatgaa[A/G]aactggatattgcttaataattgt
- ASB in cell types
- A549 (lung carcinoma) SUM159PT (pleiomorphic breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.07 | 0.65 | 2.09 | |||
| SUM159PT (pleiomorphic breast carcinoma) | 1.45 | -0.32 | 2.00 |
Items per page:
1 – 2 of 2