rs2299841 chr18:9828451 T>C
- Sequence
ccgttctagtgtcttgagtaagtg[T/C]gtgattcatgcaatttcctgtgca
- ASB in cell types
- CD14+ monocytes foreskin keratinocyte HCT-116 (colon carcinoma) macrophages
- ASB for transcription factors
- CTCF_HUMAN STAT1_HUMAN CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.08 | 1.57 | 1.69 | n/a | No Hit | |||
| STAT1_HUMAN | n/a | 2.61 | 2.00 | n/a | No Hit | |||
| CEBPB_HUMAN | 0.37 | 1.28 | 1.78 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1/fvc ratio (in asthmatic participants), decrease in fev1/fvc ratio (in nonasthmatic and asthmatic participants), decrease in fev1/fvc ratio (in nonasthmatic participants), salmonella-induced pyroptosis