rs230252 chr6:8539722 T>C
- Sequence
catgaaactgctgtaaaaagaaaa[T/C]agaaaatctgagtaatttcagttg
- ASB in cell types
- foreskin keratinocyte epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.48 | n/a | 2.33 | |||
| epithelial cell of prostate | -0.88 | 0.88 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid