rs2302762 chr17:7455542 T>C
- Sequence
gtgcggaagaagcggcccatgctc[T/C]cggaagacgctgtggttgagcatc
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells) CD4+ T-cells
- ASB for transcription factors
- GABPA_HUMAN FEZF1_HUMAN E4F1_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABPA_HUMAN | -1.35 | 1.27 | 1.56 | 3.82 | Concordant | |||
| FEZF1_HUMAN | -2.10 | 1.89 | 1.50 | n/a | No Hit | |||
| E4F1_HUMAN | -2.03 | 1.95 | 1.33 | n/a | n/a | |||
| FOXK2_HUMAN | 0.62 | 1.88 | 1.92 | n/a | n/a | |||
| SP7_HUMAN | n/a | 2.02 | 1.50 | n/a | n/a |
Items per page:
1 – 5 of 10
Motif analysis
Genetic associations
GRASP body mass index (bmi), epilepsy, height, ldl cholesterol change with statins, plasma renin activity, serum dihydrotestosterone (dht) level, serum testosterone (t) level, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood