rs2304480 chr16:56867376 A>T
- Sequence
atagatcaatagacaatagattaa[A/T]gcctgccggggagtaattagaaga
- ASB in cell types
- A549 (lung carcinoma) GM12878 (female B-cells) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.91 | -0.19 | 2.00 | |||
| GM12878 (female B-cells) | 0.24 | 0.60 | 1.32 | |||
| K562 (myelogenous leukemia) | -0.28 | 0.49 | 2.15 |
Items per page:
1 – 3 of 3