rs2305670 chr4:25914236 C>A
- Sequence
ctctccacctcttccgagcggggt[C/A]acggcccggccgtcggtaacctgg
- ASB in cell types
- HepG2 (hepatoblastoma) cranial neural crest cells breast tumor tissue CD14+ monocytes
- ASB for transcription factors
- GABPA_HUMAN COT1_HUMAN THA11_HUMAN MYB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABPA_HUMAN | 1.92 | -0.28 | 1.52 | n/a | No Hit | |||
| COT1_HUMAN | 2.64 | n/a | 2.00 | n/a | No Hit | |||
| THA11_HUMAN | 1.79 | -2.06 | 1.33 | n/a | No Hit | |||
| MYB_HUMAN | -1.50 | 1.74 | 1.50 | n/a | No Hit | |||
| ESR1_HUMAN | 1.21 | 0.57 | 2.04 | n/a | No Hit |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood