rs2305725 chr5:168486454 C>A
- Sequence
tttccgcttccgggagaggctgac[C/A]gtttccgcttccgtccacttggcg
- ASB in cell types
- CD14+ monocytes HL-60 (acute myeloid leukemia) monocyte-derived macrophages HUVEC (umbilical vein endothelial cells)
- ASB for transcription factors
- STAT1_HUMAN GABPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.65 | n/a | 2.50 | n/a | No Hit | |||
| GABPA_HUMAN | 0.30 | 1.59 | 1.33 | -2.41 | Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP body mass index (bmi), college completion, height, homa-ir, ldl cholesterol change with statins, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid