rs231872 chr11:2765831 G>T
- Sequence
cctttcccaacatgtttttgtatc[G/T]ttatattttaaagtggatttatat
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.11 | 0.53 | 2.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, nicotine dependence (smoking), prop taste detection threshold, serum creatinine, years of education